ClinVar Genomic variation as it relates to human health
NM_031844.3(HNRNPU):c.669_691del (p.Arg224fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic(1); Likely pathogenic(1); Uncertain significance(1)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_031844.3(HNRNPU):c.669_691del (p.Arg224fs)
Variation ID: 1342608 Accession: VCV001342608.4
- Type and length
-
Deletion, 23 bp
- Location
-
Cytogenetic: 1q44 1: 244863617-244863639 (GRCh38) [ NCBI UCSC ] 1: 245026919-245026941 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 26, 2022 Feb 14, 2024 Jan 17, 2022 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_031844.3:c.669_691del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_114032.2:p.Arg224fs frameshift NM_004501.3:c.634+35_634+57del intron variant NM_031844.2:c.669_691del NC_000001.11:g.244863625_244863647del NC_000001.10:g.245026927_245026949del NG_042184.1:g.5887_5909del - Protein change
- R224fs
- Other names
- -
- Canonical SPDI
- NC_000001.11:244863616:CCGCCGCCGGAGCCCCGGGGCGACCGCCGCC:CCGCCGCC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
HNRNPU | Some evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
926 | 1049 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (3) |
criteria provided, conflicting classifications
|
Jan 17, 2022 | RCV001839359.6 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(May 28, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Developmental and epileptic encephalopathy, 54
Affected status: unknown
Allele origin:
inherited
|
New York Genome Center
Study: CSER-NYCKidSeq
Accession: SCV002099367.1 First in ClinVar: Feb 26, 2022 Last updated: Feb 26, 2022 |
Comment:
The inherited heterozygous 23-nucleotide deletion identified in the HNRNPU gene has not been reported in affected individuals in theliterature. The RefSeq database contains two protein-coding … (more)
The inherited heterozygous 23-nucleotide deletion identified in the HNRNPU gene has not been reported in affected individuals in theliterature. The RefSeq database contains two protein-coding transcripts for HNRNPU; Transcript 1 encodes an 825 amino acid protein whereas transcript 2 encodesan 806 amino acid protein. Both protein isoforms are identical in sequence except that the longer isoform contains an extra 19 in-frame amino acids encoded by theextended exon 1. This 23-nucleotide deletion is located in the extend part of the exon 1 which is unique to transcript 1 (longer transcript), alters it’s wild-type translational reading frame and is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay [c.669_691del (p.Arg224GlyfsTer11)]. However, this 23-nucleotide deletion is intronic for the transcript 2 (smaller transcript) and, therefore, is not expected to alter its wild-type translational reading frame. The variant has 0.00001979 allele frequency in the gnomAD(v3) database (3 out of 151624 heterozygousalleles, no homozygotes) suggesting it is not a common benign variant in the populations represented in that database. Due to the lack of compelling evidence for its pathogenicity, the inherited heterozygous 23-nucleotide deletion identified in the HNRNPU gene is reported as a variant of uncertain significance. (less)
Clinical Features:
Seizure (present) , Migraine (present) , Neuralgia (present)
Secondary finding: no
|
|
Likely pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Developmental and epileptic encephalopathy, 54
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Neuberg Centre For Genomic Medicine, NCGM
Accession: SCV004100360.1
First in ClinVar: Nov 04, 2023 Last updated: Nov 04, 2023 |
Comment:
The frameshift deletion p.R224Gfs*11 in HNRNPU (NM_031844.3) has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. is … (more)
The frameshift deletion p.R224Gfs*11 in HNRNPU (NM_031844.3) has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. is novel (not in any individuals) in gnomAD Exomes.The p.R224Gfs*11 variant is novel (not in any individuals) in 1000 Genomes. This variant is predicted to cause loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease causing. For these reasons, this variant has been classified as Likely Pathogenic. (less)
Clinical Features:
Global developmental delay (present) , Status epilepticus (present)
|
|
Pathogenic
(Jan 17, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Developmental and epileptic encephalopathy, 54
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV003517953.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this … (more)
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant has not been reported in the literature in individuals affected with HNRNPU-related conditions. This variant is present in population databases (rs754216321, gnomAD 0.007%). This sequence change creates a premature translational stop signal (p.Arg224Glyfs*11) in the HNRNPU gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in HNRNPU are known to be pathogenic (PMID: 22678713, 28283832). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Genetic and phenotypic dissection of 1q43q44 microdeletion syndrome and neurodevelopmental phenotypes associated with mutations in ZBTB18 and HNRNPU. | Depienne C | Human genetics | 2017 | PMID: 28283832 |
Molecular characterization of 1q44 microdeletion in 11 patients reveals three candidate genes for intellectual disability and seizures. | Thierry G | American journal of medical genetics. Part A | 2012 | PMID: 22678713 |
Text-mined citations for rs754216321 ...
HelpRecord last updated Apr 06, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.